Consument Study guides, Class notes & Summaries

Looking for the best study guides, study notes and summaries about Consument? On this page you'll find 395 study documents about Consument.

All 395 results

Sort by

Samenvatting MIDTERM 2 : Consument & Marketing Samenvatting MIDTERM 2 : Consument & Marketing Popular
  • Samenvatting MIDTERM 2 : Consument & Marketing

  • Summary • 26 pages • 2024
  • Dit is een samenvatting voor de tweede midterm van het vak Consument & Marketing. Deze samenvatting bevat de hoofdstukken 7 t/m 14 van het boek Consumer Behavior (8e editie), die tot de tentamenstof behoren
    (1)
  • $4.92
  • 6x sold
  • + learn more
Samenvatting: Consument en Marketing (MIDTERM 1) Samenvatting: Consument en Marketing (MIDTERM 1) Popular
  • Samenvatting: Consument en Marketing (MIDTERM 1)

  • Summary • 22 pages • 2024 Popular
  • Dit is een samenvatting voor de eerste midterm van Consument & Marketing, waarbij de hoofdstukken 1 t/m 6 worden behandeld van het boek: Consumer Behavior, 8e editie. De samenvatting is geschreven in het Engels
    (1)
  • $4.92
  • 5x sold
  • + learn more
MNM2605 Consumer Behaviour - Assignment 4 - MW Motors Case Study
  • MNM2605 Consumer Behaviour - Assignment 4 - MW Motors Case Study

  • Essay • 12 pages • 2022
  • This assignment is about the case study of MW-Motors and how they have adapted their brand to satisfy their expanding consumer base. In this assignment we discuss the process Winnie will go through to make a decision about her purchase as well as establish the different trends that develops in consumer behaviour.
    (1)
  • $9.61
  • 2x sold
  • + learn more
Department of Life and Consumer Sciences Molecular Genetics
  • Department of Life and Consumer Sciences Molecular Genetics

  • Exam (elaborations) • 5 pages • 2022
  • Question 1 [15] Describe and illustrate how you could differentiate between these four DNA strands, using DNA melting experiments: Strand 1: 5ʹATTTTAAATTAGCATTTAAT3ʹ Strand 2: 5ʹATGCCGATATTTTTAGCGCA3ʹ Strand 3: 5ʹAGCGGGGCGGCAGCGCGGAT3ʹ Strand 4: 5ʹAGCGGGGCGGCAGCGCGGATA3ʹ Question 2 [10] Your friend studying computer science is designing a new protein folding tool that will predict protein folding pathways. Explain to them, using your UNISA BCH3703 module content, why a particul...
    (1)
  • $11.99
  • 1x sold
  • + learn more
Consumer Behavior summary
  • Consumer Behavior summary

  • Summary • 71 pages • 2023
  • An all encompassing summary of the course Consumer Behaviour. Written in an organized, structured way with plenty of clear examples and visuals to guide you through the learning process. This summary includes; * all lectures * all guest lectures * the book Nudge by Thaler and Sunstein * all the required readings (articles, videos, ...) This course is given by Clara Cutello en Barbara Briers at the Faculty of Business and Economics.
    (0)
  • $12.07
  • 3x sold
  • + learn more
Summary Consumer Behaviour Marketing Management Erasmus University
  • Summary Consumer Behaviour Marketing Management Erasmus University

  • Summary • 53 pages • 2023
  • This is an extensive summary of the subject Consumer Behaviour at Rotterdam School of Management. It includes all notes from class and examples. I got an 8.5 with this summary.
    (0)
  • $7.13
  • + learn more
AAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccurateAAFCS 200* - Consumer & Resource Management Questions and Answers 100% Accurate
  • AAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccurateAAFCS 200* - Consumer & Resource Management Questions and Answers 100% Accurate

  • Exam (elaborations) • 10 pages • 2023
  • AAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccurateAAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccurateAAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccurateAAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccuratePensions - ANSWER-are funds paid to retired employees who paid into a pension fund while they were employed. Social Security - ANSWER--A federal program under the direction of the S...
    (0)
  • $10.99
  • + learn more
AAFCS 200* - Consumer & Resource Management Exam with complete solutions
  • AAFCS 200* - Consumer & Resource Management Exam with complete solutions

  • Exam (elaborations) • 10 pages • 2023
  • AAFCS 200* - Consumer & Resource Management Exam with complete solutions
    (0)
  • $11.99
  • + learn more
Wk 3 - Apply Summative Assessment Elasticity, Consumer Choice, and Production
  • Wk 3 - Apply Summative Assessment Elasticity, Consumer Choice, and Production

  • Exam (elaborations) • 11 pages • 2023
  • 1. Which of the following statements is correct? Multiple Choice  Marginal utility is the sum of total utility.  Total utility is the sum of marginal utilities.  Total utility is the product of multiplying price times marginal utility.  Total utility is the change in marginal utility as quantity consumed increases. 2. The tables below provide Sam's total utility for coffee and tea. a. Fill in the missing values for marginal utility. Coffee and Sam's Utility Cups of Coffee...
    (0)
  • $8.99
  • + learn more
Samenvatting Marketing Communicatie Strategie
  • Samenvatting Marketing Communicatie Strategie

  • Exam (elaborations) • 77 pages • 2023
  • Samenvatting Marketing Communicatie Strategie Samenvatting Marketing Communicatie Strategie Hoofdstuk 1: Marketingcommunicatie en andere marketinginstrumenten 1.1.1 Functies van een merk voor de consument Een merk vervult zowel voor de consument als voor het bedrijf diverse functies. Voor de consumenten zijn de volgende van belang:- Gemak bij het kopenHet merk geeft de consument de zekerheid dat hij daadwerkelijk krijgt wat hij wil. En als dit een keer niet het geval is weet hij b...
    (0)
  • $15.49
  • + learn more
PGA PGM LEVEL 2 Executive Management  Test - Introduction to Consumer Behavior EXAM QUESTIONS AND ANSWERS.
  • PGA PGM LEVEL 2 Executive Management Test - Introduction to Consumer Behavior EXAM QUESTIONS AND ANSWERS.

  • Exam (elaborations) • 9 pages • 2024
  • PGA PGM LEVEL 2 Executive Management Test - Introduction to Consumer Behavior EXAM QUESTIONS AND ANSWERS.
    (0)
  • $12.49
  • + learn more